Selected article for: "expression plasmid and generate plasmid"

Author: Liu, Zhida; Zhou, Hang; Wang, Wenjun; Tan, Wenjie; Fu, Yang-Xin; Zhu, Mingzhao
Title: A novel method for synthetic vaccine construction based on protein assembly
  • Document date: 2014_12_1
  • ID: 2tazu4y6_21
    Snippet: To generate a SpyCatcherDN-OVA 8 -TBEV ED3 expression plasmid, cDNA encoding TBEV ED3 was PCR amplified with the plasmid pET-30a(1)-TBEV ED3, provided by Dr. Xiaoping Kang (Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, China), and G 4 S linker and the OVA 8 epitope (chicken ovalbumin 257-264 , or SIINFEKL) were added at the N-terminus during PCR. The primers used in the PCR were as follows: OE F (CCGCTCGAGGGCGG.....
    Document: To generate a SpyCatcherDN-OVA 8 -TBEV ED3 expression plasmid, cDNA encoding TBEV ED3 was PCR amplified with the plasmid pET-30a(1)-TBEV ED3, provided by Dr. Xiaoping Kang (Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, China), and G 4 S linker and the OVA 8 epitope (chicken ovalbumin 257-264 , or SIINFEKL) were added at the N-terminus during PCR. The primers used in the PCR were as follows: OE F (CCGCTCGAGGGCGGTG-GTGGCAGCCAGCTTGAGAGTATAATCAACTTTGAAAAAC TGACTG-AATGGACATAC ACAATGTGCG) and OE R (CCGCGAGCTCTTATCA TTTTTGGAACCATTG), in which the bold font indicates an XhoI or SacI site. The SpyCatcherDN fragment was amplified using the primers DNSc-F (GCAATTCCATATGTC GTACTACCATCAC) and DNSc-R (CCGCTCGAGAATATGAGCGTCACCTTTA G), in which the bold font indicates an NdeI or XhoI site. The SpyCatcherDN and OVA 8 -TBEV ED3 fragments were then ligated and cloned into pDEST14 at the NdeI and SacI sites. Expression and purification of the SpyCatcherDN-OVA 8 -TBEV ED3 protein were performed as described above.

    Search related documents:
    Co phrase search for related documents
    • bold font and purification expression: 1
    • PCR primer and purification expression: 1, 2, 3