Selected article for: "bold font and expression plasmid"

Author: Liu, Zhida; Zhou, Hang; Wang, Wenjun; Tan, Wenjie; Fu, Yang-Xin; Zhu, Mingzhao
Title: A novel method for synthetic vaccine construction based on protein assembly
  • Document date: 2014_12_1
  • ID: 2tazu4y6_22
    Snippet: A plasmid encoding the DNA sequence of the variable regions of the heavy and light chains of anti-DEC205 (clone NLDC145) was kindly provided by Dr. Ralph Steinman (The Rockefeller University, USA). The single chain-encoding DNA was PCR amplified using the following primers: DEC205 F, GCG CGTACGGAGG-TGAAGCTGTTGGAATC and DEC205 R, GCGTTCGAACCGTTT CAATT-CCAGCTTGG. The DNA was then cloned into the pEE12.4 expression plasmid (Lonza, Basel, Switzerland.....
    Document: A plasmid encoding the DNA sequence of the variable regions of the heavy and light chains of anti-DEC205 (clone NLDC145) was kindly provided by Dr. Ralph Steinman (The Rockefeller University, USA). The single chain-encoding DNA was PCR amplified using the following primers: DEC205 F, GCG CGTACGGAGG-TGAAGCTGTTGGAATC and DEC205 R, GCGTTCGAACCGTTT CAATT-CCAGCTTGG. The DNA was then cloned into the pEE12.4 expression plasmid (Lonza, Basel, Switzerland) between the IgGk leading sequence and the human IgG Fc sequence using BsiWI and BstBI (bold font). The SpyTag-encoding sequence (GCTCACATCGTGATGGTGGACGCCTACAAGCCCACCAAG) and a GSGESG linker (GGATCCGGCGAGTCCGGC) were then genetically fused to the C-terminus of the human IgG Fc fragment by PCR to construct the final plasmid pEE12.4 aDEC205-SpyTag. Figure 6 | Perspective on protein assembly-based synthetic vaccine R&D. During the R&D of vaccines against cancer and infectious diseases, especially in the era of big data, many functional units (such as immune molecules) and antigens are available for screening and optimization. The conventional way (left) of making synthetic vaccines usually completely depends on de novo construction, and each combination has to be made individually, which is time consuming and costly. By taking advantage of a protein assembly-based method (right), each vaccine component can be prepared and then simply assembled into a full vaccine, as needed. This procedure could be easier, faster, more flexible and more efficient. Ag, antigen. For the in vivo assay, naïve WT C57BL/6 mice were injected subcutaneously in the tail base with 200 pmol of the aDEC205-Sc-OVA 8 -ED3 adduct, aDEC205-SpyTag or isotype-control antibody. After 20 h, inguinal DLNs were collected and digested to form a single-cell suspension. The cells were stained with an anti-FccR mAb, followed by PE-conjugated anti-human IgG antibody staining before flow cytometry analysis.

    Search related documents: