Author: Kruse, Susanne; Zhong, Silin; Bodi, Zsuzsanna; Button, James; Alcocer, Marcos J. C.; Hayes, Christopher J.; Fray, Rupert
Title: A novel synthesis and detection method for cap-associated adenosine modifications in mouse mRNA Document date: 2011_10_24
ID: 69vuc6l9_20
Snippet: Apoa1forward GCTCCGGGGAGGTCACCCACACCT and Apoa1reverse CAATGGGCCCAGCCGTTCCTGCAGC; Albforward CCCCACTAGCCTCTGGCAAAATGAAGTG and Albreverse GGCTGGGGTTGTCATCTTTGTGTTGCAG; Prm2forward GCTGGGTGTGCGCGAGTCAGGGGCTC and Prm2reverse CTTGTGGATCCTATGTAGCCTCTTACG; Pabpc1forward CGGCGGTTAGTGCTGAGAGTGCGGAG and Pabpc1reverse GAAGTTCACGTACGCGTAGCCCAAGG. Prior to amplification, the forward oligonucleotides were 5' phosphorylated, the amplification products were sub.....
Document: Apoa1forward GCTCCGGGGAGGTCACCCACACCT and Apoa1reverse CAATGGGCCCAGCCGTTCCTGCAGC; Albforward CCCCACTAGCCTCTGGCAAAATGAAGTG and Albreverse GGCTGGGGTTGTCATCTTTGTGTTGCAG; Prm2forward GCTGGGTGTGCGCGAGTCAGGGGCTC and Prm2reverse CTTGTGGATCCTATGTAGCCTCTTACG; Pabpc1forward CGGCGGTTAGTGCTGAGAGTGCGGAG and Pabpc1reverse GAAGTTCACGTACGCGTAGCCCAAGG. Prior to amplification, the forward oligonucleotides were 5' phosphorylated, the amplification products were subsequently digested with lambda nuclease (New England BioLabs) to leave the single stranded antisense DNA strand. 100 ng of this ssDNA (2 ml) was spotted onto 2 mm 3 2 mm teeth cut from a Hybond N 1 membrane ( Amersham) (Fig. 2B,C) , and UV cross-linked (Stratalinker). Membranes were prehybridised at 42 uC in 40 % formamide with 5 3 Denhardt's, 3 % SDS, 0.3 M NaCl, 50 mM sodium phosphate buffer (pH 7.0) and 0.1 mg ml 21 sonicated salmon sperm DNA. 600 ng of poly(A) RNA was digested with 20 units of Tobacco Acid Pyrophosphatase (Epicentre) for 30 minutes at 37 uC. The 5' phosphate of the exposed cap adjacent nucleotide was removed by the addition of 10 units of Alkaline Phosphatase (Fermentas) and incubation for a further 15 minutes at 37 uC. After phenol-chloroform extraction and ethanol precipitation, RNA samples were resuspended in 20 ml of sterile distilled water and 5' ends were labelled using 30 units T4 polynucleotide kinase (PNK, Fermentas) and 7.4 MBq [c-32 P] ATP at 37 uC for 30 minutes. The PNK was heat inactivated (70 uC for 15 min) and the reaction made up to 60 ml with sterile distilled water then passed through a P-30 spin column (Bio-Rad) to remove unincorporated isotope. A 1 ml aliquot was taken, added to 9 ml of nuclease P1 buffer and digested with P1 (Sigma) for one hour at 37 uC. 1.5 ml of the released 5' monophosphates from this digest was then analysed by 2D TLC as described previously 25 . The remaining end labelled RNA was fragmented to lengths of approximately 120 nt by the addition of Na 2 CO 3 to a final concentration of 60 mM and NaHCO 3 to a final concentration of 40 mM followed by incubation for one hour at 60 uC.12 ml 3M sodium acetate pH 5.2 was then added and the RNA precipitated with ethanol. The pellet was resuspended in 200 ml of pre-hybridisation buffer then added to the membranes (final volume 2 ml) and hybridised overnight at 42 uC. Membrane washings were carried out with 2 3, 1 3 and 0.2 3 SSC, 0.1% SDS. Two final washes were carried out at 60 uC, with 0.2 3 SSC but with the SDS omitted. Hybridised membranes were exposed to storage phosphor screens (K-screen; KODAK) and imaged using Bio-Rad Molecular Imager FX in combination with Quantity One 4.6.3 software (Bio-Rad). Individual teeth containing the target mRNAs end labelled at the cap adjacent position were cut off and digested with P1 nuclease (Sigma) in a final volume of 3 ml. All of this digestion mix was applied to a cellulose coated TLC plate (20 3 20 cm, MERCK) and developed as described previously 25 .
Search related documents:
Co phrase search for related documents- cap adjacent position and ethanol phenol chloroform extraction precipitation: 1
- cap adjacent position and Membrane washing: 1
- cap adjacent position and P1 nuclease: 1
- cap adjacent position and phenol chloroform: 1
- cap adjacent position and phenol chloroform extraction: 1
- cap adjacent position and polynucleotide kinase: 1
- cap adjacent position and RNA label: 1
Co phrase search for related documents, hyperlinks ordered by date