Author: Gomez, D.E.; Arroyo, L.G.; Costa, M.C.; Viel, L.; Weese, J.S.
Title: Characterization of the Fecal Bacterial Microbiota of Healthy and Diarrheic Dairy Calves Document date: 2017_4_7
ID: 2vraae5h_8
Snippet: Total DNA was extracted from 200 mg (wet weight) of fecal samples with a commercial Kit. c The V4 region of the 16S rRNA gene was amplified with the forward (5 0 -AYTGGGYDTA AAGNG-3 0 ) and reverse (5 0 -TACNVGGGTATCTAATCC-3 0 ) primers 14 The primers were designed with overhanging adapters (Forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, Reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGAC AG) for annealing to Illumina universal index sequencing adaptors that .....
Document: Total DNA was extracted from 200 mg (wet weight) of fecal samples with a commercial Kit. c The V4 region of the 16S rRNA gene was amplified with the forward (5 0 -AYTGGGYDTA AAGNG-3 0 ) and reverse (5 0 -TACNVGGGTATCTAATCC-3 0 ) primers 14 The primers were designed with overhanging adapters (Forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, Reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGAC AG) for annealing to Illumina universal index sequencing adaptors that were added in a later PCR. The reaction mixture and amplification conditions have been described previously. 15 The PCR products were purified with magnetic beads. d Illumina universal adapters (Forward: AATGATACGG CGACCACCGAGATCT ACAC-index-TCGTCGGCAGCGTC, Reverse: CAAGCAGAAG ACGGCATACGAGAT-index-GTCTCGTGGGCTCGG) then were added to the purified 16S rRNA gene product by PCR. 15 The PCR products were evaluated by electrophoresis in 1.5% agarose gel and purified as described above. After purification, spectrophotometry e was used to quantify the PCR products. Samples were normalized to a final concentration of 2 nM. The library pool was submitted to the Genomics Facility of the University of Guelph and sequenced with an Illumina MiSeq f for 250 cycles from each end.
Search related documents:
Co phrase search for related documents- PCR product and rrna gene: 1, 2, 3
- reaction mixture and rrna gene: 1
Co phrase search for related documents, hyperlinks ordered by date