Selected article for: "final concentration and total dna"

Author: Gomez, D.E.; Arroyo, L.G.; Costa, M.C.; Viel, L.; Weese, J.S.
Title: Characterization of the Fecal Bacterial Microbiota of Healthy and Diarrheic Dairy Calves
  • Document date: 2017_4_7
  • ID: 2vraae5h_8
    Snippet: Total DNA was extracted from 200 mg (wet weight) of fecal samples with a commercial Kit. c The V4 region of the 16S rRNA gene was amplified with the forward (5 0 -AYTGGGYDTA AAGNG-3 0 ) and reverse (5 0 -TACNVGGGTATCTAATCC-3 0 ) primers 14 The primers were designed with overhanging adapters (Forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, Reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGAC AG) for annealing to Illumina universal index sequencing adaptors that .....
    Document: Total DNA was extracted from 200 mg (wet weight) of fecal samples with a commercial Kit. c The V4 region of the 16S rRNA gene was amplified with the forward (5 0 -AYTGGGYDTA AAGNG-3 0 ) and reverse (5 0 -TACNVGGGTATCTAATCC-3 0 ) primers 14 The primers were designed with overhanging adapters (Forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, Reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGAC AG) for annealing to Illumina universal index sequencing adaptors that were added in a later PCR. The reaction mixture and amplification conditions have been described previously. 15 The PCR products were purified with magnetic beads. d Illumina universal adapters (Forward: AATGATACGG CGACCACCGAGATCT ACAC-index-TCGTCGGCAGCGTC, Reverse: CAAGCAGAAG ACGGCATACGAGAT-index-GTCTCGTGGGCTCGG) then were added to the purified 16S rRNA gene product by PCR. 15 The PCR products were evaluated by electrophoresis in 1.5% agarose gel and purified as described above. After purification, spectrophotometry e was used to quantify the PCR products. Samples were normalized to a final concentration of 2 nM. The library pool was submitted to the Genomics Facility of the University of Guelph and sequenced with an Illumina MiSeq f for 250 cycles from each end.

    Search related documents:
    Co phrase search for related documents
    • agarose gel and commercial kit: 1, 2
    • agarose gel and final concentration: 1, 2, 3, 4, 5, 6
    • agarose gel and PCR product: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24
    • agarose gel and reaction mixture: 1, 2, 3, 4, 5, 6, 7, 8
    • agarose gel and rrna gene: 1, 2, 3
    • agarose gel electrophoresis and amplification reaction mixture: 1, 2
    • agarose gel electrophoresis and final concentration: 1, 2
    • agarose gel electrophoresis and PCR product: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
    • agarose gel electrophoresis and reaction mixture: 1, 2, 3, 4, 5, 6, 7
    • agarose gel electrophoresis and rrna gene: 1, 2, 3
    • amplification reaction mixture and PCR product: 1, 2, 3
    • amplification reaction mixture and reaction mixture: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12
    • amplification reaction mixture and rrna gene: 1