Selected article for: "cell culture and fetal tissue"

Author: Wilson, Michael R.; Suan, Dan; Duggins, Andrew; Schubert, Ryan D.; Khan, Lillian M.; Sample, Hannah A.; Zorn, Kelsey C.; Rodrigues Hoffman, Aline; Blick, Anna; Shingde, Meena; DeRisi, Joseph L.
Title: A novel cause of chronic viral meningoencephalitis: Cache Valley virus
  • Document date: 2017_7_25
  • ID: 5mddyv0n_15
    Snippet: Reverse transcription-PCR (RT-PCR) was performed on the patient's brain biopsy tissue and CSF using previously published CVV primers for the polyprotein gene (ie, CVV forward [CCAATGCAATTCAGGGCAGT] and reverse [TGAGTCACCACATGCTGTAAGGT]) according to a slightly modified version of a published protocol. 21 RT-PCR was unsuccessful from CSF, but the amplicon from the brain biopsy tissue RNA was cloned into One Shot TOP10 chemically competent Escheric.....
    Document: Reverse transcription-PCR (RT-PCR) was performed on the patient's brain biopsy tissue and CSF using previously published CVV primers for the polyprotein gene (ie, CVV forward [CCAATGCAATTCAGGGCAGT] and reverse [TGAGTCACCACATGCTGTAAGGT]) according to a slightly modified version of a published protocol. 21 RT-PCR was unsuccessful from CSF, but the amplicon from the brain biopsy tissue RNA was cloned into One Shot TOP10 chemically competent Escherichia coli using the TOPO-TA cloning kit according to the manufacturer's protocol (Thermo Fisher Scientific, Waltham, MA). Ampicillin-resistant colonies were Sanger sequenced (Quintara Biosciences, South San Francisco, CA). The cloned sequence unambiguously aligned to CVV (98% similarity); a Basic Local Alignment Search Tool search of NCBI also returned only CVV hits and did not align to any other viruses. The RNA-dependent RNA polymerase sequence of the most closely related Australian orthobunyavirus, Kowanyama virus (GenBank KC436108.1), had only 80% similarity to the viral polymerase sequences obtained from our subject's sample. 22 Virus culture with fresh CSF was attempted on multiple cell lines (Vero, Vero E6, Aedes albopictus [C6/36], buffalo green monkey kidney, human fetal lung , and rhabdomyosarcoma [RD]) without success. Immunohistochemistry was performed on 5 lm sections of formalin-fixed, paraffin-embedded tissues following previously described methods with minor modifications, including a rabbit polyclonal antibody against CVV at 1:100 dilution or normal rabbit IgG incubation for 1 hour, a serum-free protein block incubation (Dako, Carpinteria, CA), and a polymer-based secondary antibody incubation (Thermo Fisher Scientific, Fremont, CA). 23 Ovine fetal central nervous system (CNS) tissue and skeletal muscle experimentally infected with CVV and noninfected human brain tissue were included as positive and negative controls, respectively. The experimentally infected ovine fetus demonstrated strong intracytoplasmic immunostaining. No immunostaining was observed in the noninfected human negative control brain tissue. The subject's brain showed intracytoplasmic immunostaining, primarily seen within glial cells forming glial nodules in the brain parenchyma (Fig 4) .

    Search related documents:
    Co phrase search for related documents
    • Aedes albopictus and cell line: 1, 2
    • Aedes albopictus and central nervous system: 1
    • antibody incubation and cell line: 1
    • Basic Local Alignment Search Tool search and cell line: 1
    • biopsy tissue and brain biopsy tissue: 1, 2, 3, 4, 5, 6, 7
    • biopsy tissue and brain parenchyma: 1
    • biopsy tissue and brain tissue: 1, 2, 3, 4, 5, 6
    • biopsy tissue and central nervous system: 1, 2, 3, 4
    • biopsy tissue and CNS tissue: 1
    • biopsy tissue and CSF brain biopsy tissue: 1
    • brain biopsy tissue and central nervous system: 1, 2
    • brain biopsy tissue and CSF brain biopsy tissue: 1
    • brain parenchyma and cell line: 1, 2
    • brain parenchyma and central nervous system: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • brain tissue and cell line: 1, 2, 3, 4, 5, 6
    • brain tissue and central nervous system: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • brain tissue and CNS tissue: 1, 2, 3, 4, 5, 6, 7, 8, 9
    • brain tissue and CSF brain biopsy tissue: 1
    • cell line and clone sequence: 1