Selected article for: "EGFR mutation and LAMP Therascreen"

Author: Horiuchi, Sho; Saito, Yuichi; Matsui, Atsuka; Takahashi, Nobumasa; Ikeya, Tomohiko; Hoshi, Eishin; Shimizu, Yoshihiko; Yasuda, Masanori
Title: A novel loop-mediated isothermal amplification method for efficient and robust detection of EGFR mutations
  • Document date: 2020_1_14
  • ID: 4sltubqk_12
    Snippet: To reconfirm the status of EGFR mutation in Case X, four additional FFPE tissue blocks in Case X were used to extract further DNA samples. The hematoxylin-eosin (HE) images of these FFPE blocks are presented in Fig. 2 . Following removal of normal lung tissues, DNA samples were extracted as aforementioned, and investigated using Therascreen EGFR PCR and a LAMP assay. In all the four samples, the deletion mutation in exon 19 was identified using b.....
    Document: To reconfirm the status of EGFR mutation in Case X, four additional FFPE tissue blocks in Case X were used to extract further DNA samples. The hematoxylin-eosin (HE) images of these FFPE blocks are presented in Fig. 2 . Following removal of normal lung tissues, DNA samples were extracted as aforementioned, and investigated using Therascreen EGFR PCR and a LAMP assay. In all the four samples, the deletion mutation in exon 19 was identified using both Therascreen PCR and LAMP assays. Furthermore, direct sequencing revealed a novel exon 19 EGFR deletion mutation in samples a and b; NG_007726.3: g.160744_160761delinsGCA represented the deletion of nucleotides g.160744 to g.160761 (ATTAAGAGAAGCAACATC, data not shown), which were replaced by a GCA nucleotide triplet, changing GGAATTAAGAGAAGCAACATCTCC to GGAGCATCC (data not shown), resulting in shortening substation in the protein (p.Leu747_Ser752delinsHis).

    Search related documents:
    Co phrase search for related documents
    • Try single phrases listed below for: 1