Author: Horiuchi, Sho; Saito, Yuichi; Matsui, Atsuka; Takahashi, Nobumasa; Ikeya, Tomohiko; Hoshi, Eishin; Shimizu, Yoshihiko; Yasuda, Masanori
Title: A novel loop-mediated isothermal amplification method for efficient and robust detection of EGFR mutations Document date: 2020_1_14
ID: 4sltubqk_12
Snippet: To reconfirm the status of EGFR mutation in Case X, four additional FFPE tissue blocks in Case X were used to extract further DNA samples. The hematoxylin-eosin (HE) images of these FFPE blocks are presented in Fig. 2 . Following removal of normal lung tissues, DNA samples were extracted as aforementioned, and investigated using Therascreen EGFR PCR and a LAMP assay. In all the four samples, the deletion mutation in exon 19 was identified using b.....
Document: To reconfirm the status of EGFR mutation in Case X, four additional FFPE tissue blocks in Case X were used to extract further DNA samples. The hematoxylin-eosin (HE) images of these FFPE blocks are presented in Fig. 2 . Following removal of normal lung tissues, DNA samples were extracted as aforementioned, and investigated using Therascreen EGFR PCR and a LAMP assay. In all the four samples, the deletion mutation in exon 19 was identified using both Therascreen PCR and LAMP assays. Furthermore, direct sequencing revealed a novel exon 19 EGFR deletion mutation in samples a and b; NG_007726.3: g.160744_160761delinsGCA represented the deletion of nucleotides g.160744 to g.160761 (ATTAAGAGAAGCAACATC, data not shown), which were replaced by a GCA nucleotide triplet, changing GGAATTAAGAGAAGCAACATCTCC to GGAGCATCC (data not shown), resulting in shortening substation in the protein (p.Leu747_Ser752delinsHis).
Search related documents:
Co phrase search for related documents- EGFR deletion and novel exon: 1
- EGFR deletion mutation and LAMP assay: 1
- EGFR deletion mutation and novel exon: 1
- EGFR mutation and LAMP assay: 1, 2, 3
- EGFR mutation and novel exon: 1
- lung tissue and normal lung tissue: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38
- lung tissue and tissue block: 1
Co phrase search for related documents, hyperlinks ordered by date