Selected article for: "MERS cov and restriction site"

Author: Almazán, Fernando; DeDiego, Marta L.; Sola, Isabel; Zuñiga, Sonia; Nieto-Torres, Jose L.; Marquez-Jurado, Silvia; Andrés, German; Enjuanes, Luis
Title: Engineering a Replication-Competent, Propagation-Defective Middle East Respiratory Syndrome Coronavirus as a Vaccine Candidate
  • Document date: 2013_9_10
  • ID: 14yfs4pa_35
    Snippet: Construction of MERS-CoV cDNA clones lacking accessory genes 3, 4a, 4b, and 5. The deletion of gene 3 was generated by PCR-directed mutagenesis using the plasmid pUC-MERS-1 (a pUC plasmid containing the MERS-1 fragment spanning nucleotides 20,898 to 25,836 of the MERS-CoV genome) as the template and the oligonucleotides MERS-S-Tth111I-VS (5= TGCTATTTGACAAAGTCACTATAGCTGATC 3=, where the restriction site Tth111I is underlined) and MERS-S-PacI-RS (5.....
    Document: Construction of MERS-CoV cDNA clones lacking accessory genes 3, 4a, 4b, and 5. The deletion of gene 3 was generated by PCR-directed mutagenesis using the plasmid pUC-MERS-1 (a pUC plasmid containing the MERS-1 fragment spanning nucleotides 20,898 to 25,836 of the MERS-CoV genome) as the template and the oligonucleotides MERS-S-Tth111I-VS (5= TGCTATTTGACAAAGTCACTATAGCTGATC 3=, where the restriction site Tth111I is underlined) and MERS-S-PacI-RS (5= CCCTTAATTAACTGAGTAACCAACGTCAAAAAGATTCACACT ATTAGTGAACATGAACCTTATGCGGCTCGAGGTCGTATTCC 3=, where the restriction site PacI is underlined). The PCR product, including the deletion (from nucleotides 25,518 to 25,803), was digested with Tth111I and PacI and cloned into the same sites of pUC-MERS-1, leading to pUC-MERS-1-⌬3. To generate pBAC-MERS-⌬3, the SwaI-PacI digestion product from pUC-MERS-1-⌬3 was cloned into the same restriction sites of pBAC-MERS FL (Fig. 3A) .

    Search related documents:
    Co phrase search for related documents
    • accessory gene and MERS cov genome: 1
    • accessory gene and nucleotide deletion: 1
    • digestion product and restriction site: 1
    • MERS cov and nucleotide deletion: 1, 2
    • MERS cov and PacI restriction site: 1
    • MERS cov and PCR direct: 1, 2
    • MERS cov and PCR product: 1
    • MERS cov and restriction site: 1, 2, 3, 4, 5
    • MERS cov genome and PacI restriction site: 1
    • MERS cov genome and PCR product: 1
    • MERS cov genome and restriction site: 1
    • nucleotide deletion and PCR product: 1, 2, 3
    • PacI restriction site and PCR product: 1